Bitacoreando

Dos videos muy impresionantes de gente hábil

Guitar

Precision flight

En .

[tags]habilidad, RC, model airplanes,indoor,skill[/tags]

Nokia releases ‘Web Browser for S60′ engine code to open source community
El fabricante finlandés de teléfonos celulares, Nokia, liberó ayer el código fuente de su navegador de web “WebKit” para el sistema S60, con una licencia BSD.

S60 es el sofware que mueve no solo a los celulares Nokia, sino a los Panasonic y a los Siemens. Creo que es una nota relevante.

Last chromosome in human genome sequenced | Reuters.com

Lo chistoso son los comentarios en /. :

Part of the sequence:

(Score:5, Funny)

by GroeFaZ (850443)

on 17/05/06 20:27 (#15355442)

ACGATCGTACGcopyrightTAGATCGCGTAGTAGCTAGCTGTbyGGCGG CGGTACGGCTATiehovaAGTCGATCGATGATCG5billionBC-TAGCT AGCTAGCTAGCTAGinfinityTAGTAGTATTTATTTunauthorizedA GGCGGTATGCTAGCTAGreproductionCTGATGTGTAGCCCAprohib itedCCAGCTTAGCTAbyGCTAGCTAGTGTAAATCGCCATCGCGCCTAdi vineTTCTCTAGAGCTTAGCATGCTAlawCGTACGTAGCTA

[ Reply to This

]

• Re:Part of the sequence: by KarmaOverDogma (Score:2) 17/05/06 20:47
• Re:Part of the sequence:

  (Score:5, Funny)

  by ggvaidya (747058)
  
  on 17/05/06 21:51 (#15355824)
  
  (http://thingspeoplesaid.blogspot.com/ | Last Journal: 15/02/05 3:38)

  ACTTTTTCGCGAGAGGAGAGTGAGT//todo:this should only return a positive values!AAAAAATTTCTATCTACTATCTACATATCATTACA/*warnin g we are kluding around the antique “arthropod” module, here there be bugs!*/AAAACTCTTATCTATTTATTCATCTATCATTCATCTATCATCT ACTACTATCTAATCTATACA//haha nice hackACTCTACTATAGATCGATGT

  –
  A blog I keep [freshdurians.com]

  [ Reply to This
  | Parent
  ]
  • 1 reply

    beneath your current threshold.

• Re:Part of the sequence: by norminator (Score:2) 18/05/06 11:55
• 2 replies
  beneath your current threshold.