-
Rubén Marrero
30-something, Mexico City
Technology / Politics / Culture / Society / Business
Monthly Archives: May 2006
Gente hábil y no pedazos
ShareDos videos muy impresionantes de gente hábil Guitar Precision flight En . [tags]habilidad, RC, model airplanes,indoor,skill[/tags]
Posted in Bitacoreando
1 Comment
Otro navegador OSS: Nokia WebKit
Share Nokia releases ‘Web Browser for S60′ engine code to open source community El fabricante finlandés de teléfonos celulares, Nokia, liberó ayer el código fuente de su navegador de web “WebKit” para el sistema S60, con una licencia BSD. S60 … Continue reading
Posted in Mobile, Tech stuff
Leave a comment
Se decodifica el último gen humano
ShareLast chromosome in human genome sequenced | Reuters.com Lo chistoso son los comentarios en /. : Part of the sequence: (Score:5, Funny) by GroeFaZ (850443) on 17/05/06 20:27 (#15355442) ACGATCGTACGcopyrightTAGATCGCGTAGTAGCTAGCTGTbyGGCGG CGGTACGGCTATiehovaAGTCGATCGATGATCG5billionBC-TAGCT AGCTAGCTAGCTAGinfinityTAGTAGTATTTATTTunauthorizedA GGCGGTATGCTAGCTAGreproductionCTGATGTGTAGCCCAprohib itedCCAGCTTAGCTAbyGCTAGCTAGTGTAAATCGCCATCGCGCCTAdi vineTTCTCTAGAGCTTAGCATGCTAlawCGTACGTAGCTA [ Reply to This ] … Continue reading
Posted in Bitacoreando
Leave a comment
